Transcript: Human XM_011538001.2

PREDICTED: Homo sapiens coiled-coil domain containing 63 (CCDC63), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC63 (160762)
Length:
2228
CDS:
478..2169

Additional Resources:

NCBI RefSeq record:
XM_011538001.2
NBCI Gene record:
CCDC63 (160762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136350 GAGATTGAAGACCTACGATTT pLKO.1 1018 CDS 100% 10.800 15.120 N CCDC63 n/a
2 TRCN0000138931 GACATCAACCTTCCGCAGTAT pLKO.1 1795 CDS 100% 4.950 6.930 N CCDC63 n/a
3 TRCN0000137699 GCAGAAGATTGCGAGTCAGTA pLKO.1 636 CDS 100% 4.950 6.930 N CCDC63 n/a
4 TRCN0000138833 GCAGAAATTGTCCCACGATGA pLKO.1 1578 CDS 100% 4.050 5.670 N CCDC63 n/a
5 TRCN0000135849 CTAAACCAGCTCATTGAAGAT pLKO.1 1432 CDS 100% 4.950 3.465 N CCDC63 n/a
6 TRCN0000138107 GTTCCGAAACCAGCAGAAGAT pLKO.1 624 CDS 100% 4.950 3.465 N CCDC63 n/a
7 TRCN0000138512 CTCTCAGTACAACCTGGAGAT pLKO.1 1203 CDS 100% 4.050 2.835 N CCDC63 n/a
8 TRCN0000138012 GCTCCAAACTAAGGAGGACTA pLKO.1 774 CDS 100% 4.050 2.835 N CCDC63 n/a
9 TRCN0000138389 CAGCAGAAATTGTCCCACGAT pLKO.1 1576 CDS 100% 2.640 1.848 N CCDC63 n/a
10 TRCN0000136471 CGACAATTATATCCTGAAGGA pLKO.1 2067 CDS 100% 2.640 1.848 N CCDC63 n/a
11 TRCN0000138390 CGTCAAGCTGAATGATCGCAA pLKO.1 1278 CDS 100% 2.640 1.848 N CCDC63 n/a
12 TRCN0000138373 CAAGGAGATCAAGACCCTGAA pLKO.1 657 CDS 100% 4.050 2.430 N CCDC63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.