Transcript: Human XM_011538169.2

PREDICTED: Homo sapiens zinc finger protein 385A (ZNF385A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF385A (25946)
Length:
2360
CDS:
90..1238

Additional Resources:

NCBI RefSeq record:
XM_011538169.2
NBCI Gene record:
ZNF385A (25946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137778 GTTTCCGTATCGTCAACCCTT pLKO.1 2186 3UTR 100% 2.640 3.696 N ZNF385A n/a
2 TRCN0000134534 GCACATAACAAAGGTACTAAG pLKO.1 729 CDS 100% 10.800 7.560 N ZNF385A n/a
3 TRCN0000240781 GCACATAACAAAGGTACTAAG pLKO_005 729 CDS 100% 10.800 7.560 N Zfp385a n/a
4 TRCN0000138404 CCAGCTTGAGGCACATAACAA pLKO.1 719 CDS 100% 5.625 3.938 N ZNF385A n/a
5 TRCN0000137258 GAGGCACATAACAAAGGTACT pLKO.1 726 CDS 100% 4.050 2.835 N ZNF385A n/a
6 TRCN0000137159 GATCTGCAATGTCAAGGTCAA pLKO.1 869 CDS 100% 4.050 2.835 N ZNF385A n/a
7 TRCN0000136774 CTCCCTAAATGATCTCTCCTT pLKO.1 1326 3UTR 100% 2.640 1.848 N ZNF385A n/a
8 TRCN0000138892 GCACTACAAAGGTAATCGCCA pLKO.1 350 CDS 100% 0.660 0.462 N ZNF385A n/a
9 TRCN0000138468 CTTCAGCAACTACAGCACCAT pLKO.1 317 CDS 100% 2.640 1.584 N ZNF385A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.