Transcript: Human XM_011538371.2

PREDICTED: Homo sapiens musashi RNA binding protein 1 (MSI1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSI1 (4440)
Length:
1843
CDS:
75..749

Additional Resources:

NCBI RefSeq record:
XM_011538371.2
NBCI Gene record:
MSI1 (4440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310760 ACGACGCCATGCTGATGTTTG pLKO_005 67 5UTR 100% 10.800 15.120 N MSI1 n/a
2 TRCN0000295221 TTGCCACAGCCTTCACCAATG pLKO_005 718 CDS 100% 6.000 4.200 N Msi1 n/a
3 TRCN0000064007 CACGTTTGAGAGTGAGGACAT pLKO.1 125 CDS 100% 4.050 2.835 N MSI1 n/a
4 TRCN0000299701 CACGTTTGAGAGTGAGGACAT pLKO_005 125 CDS 100% 4.050 2.835 N MSI1 n/a
5 TRCN0000064004 CCCTTTGATTGCCACAGCCTT pLKO.1 710 CDS 100% 2.640 1.848 N MSI1 n/a
6 TRCN0000299699 CCCTTTGATTGCCACAGCCTT pLKO_005 710 CDS 100% 2.640 1.848 N MSI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.