Transcript: Human XM_011538538.3

PREDICTED: Homo sapiens stabilin 2 (STAB2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAB2 (55576)
Length:
7041
CDS:
228..6956

Additional Resources:

NCBI RefSeq record:
XM_011538538.3
NBCI Gene record:
STAB2 (55576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157919 CGGGTTAAAGACTGGGACAAA pLKO.1 5160 CDS 100% 4.950 6.930 N STAB2 n/a
2 TRCN0000157768 CGTGTGAGTGTAACCTGGATT pLKO.1 6424 CDS 100% 4.950 6.930 N STAB2 n/a
3 TRCN0000109511 GCTCCAATAAACTACACCAAT pLKO.1 3957 CDS 100% 4.950 6.930 N Stab2 n/a
4 TRCN0000150874 GCTCCAATAAACTACACCAAT pLKO.1 3957 CDS 100% 4.950 6.930 N STAB2 n/a
5 TRCN0000156562 GCTTGGAACAAACCGGGAAAT pLKO.1 3097 CDS 100% 10.800 7.560 N STAB2 n/a
6 TRCN0000157184 CCGGATGGTTACACCATGATT pLKO.1 390 CDS 100% 5.625 3.938 N STAB2 n/a
7 TRCN0000157840 CCTGGAAATCAACCCGTGTTT pLKO.1 4760 CDS 100% 4.950 3.465 N STAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.