Transcript: Human XM_011538613.2

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 11 (PTPN11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN11 (5781)
Length:
6109
CDS:
198..1988

Additional Resources:

NCBI RefSeq record:
XM_011538613.2
NBCI Gene record:
PTPN11 (5781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005003 CGCTAAGAGAACTTAAACTTT pLKO.1 1384 CDS 100% 5.625 7.875 N PTPN11 n/a
2 TRCN0000350368 CGCTAAGAGAACTTAAACTTT pLKO_005 1384 CDS 100% 5.625 7.875 N PTPN11 n/a
3 TRCN0000029877 CGTGTTAGGAACGTCAAAGAA pLKO.1 1344 CDS 100% 5.625 7.875 N Ptpn11 n/a
4 TRCN0000327986 CGTGTTAGGAACGTCAAAGAA pLKO_005 1344 CDS 100% 5.625 7.875 N Ptpn11 n/a
5 TRCN0000005002 GCAGTTAAATTGTGCGCTGTA pLKO.1 2278 3UTR 100% 4.050 5.670 N PTPN11 n/a
6 TRCN0000314563 GCAGTTAAATTGTGCGCTGTA pLKO_005 2278 3UTR 100% 4.050 5.670 N PTPN11 n/a
7 TRCN0000350369 TATACCCTTAACCAGTTTAAT pLKO_005 2354 3UTR 100% 15.000 10.500 N PTPN11 n/a
8 TRCN0000355887 AGTCTAAAGTGACCCATGTTA pLKO_005 685 CDS 100% 5.625 3.938 N PTPN11 n/a
9 TRCN0000005005 CGGTCCAGCATTATATTGAAA pLKO.1 1756 CDS 100% 5.625 3.938 N PTPN11 n/a
10 TRCN0000005006 GCAAATATCATCATGCCTGAA pLKO.1 1113 CDS 100% 4.050 2.835 N PTPN11 n/a
11 TRCN0000355818 AGATGTCATTGAGCTTAAATA pLKO_005 473 CDS 100% 15.000 9.000 N PTPN11 n/a
12 TRCN0000314564 GGATTCAAATTCTAGTAATAG pLKO_005 2314 3UTR 100% 13.200 7.920 N PTPN11 n/a
13 TRCN0000005004 GCTGAAATAGAAAGCAGAGTT pLKO.1 864 CDS 100% 4.950 2.970 N PTPN11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.