Transcript: Human XM_011538867.3

PREDICTED: Homo sapiens lysine demethylase 2B (KDM2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM2B (84678)
Length:
5647
CDS:
1358..5419

Additional Resources:

NCBI RefSeq record:
XM_011538867.3
NBCI Gene record:
KDM2B (84678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118439 GAGATGAGCATGTCCCAGTTT pLKO.1 1805 CDS 100% 4.950 6.930 N KDM2B n/a
2 TRCN0000122422 GCTGCACAATTTGGCGCTGTA pLKO.1 2158 CDS 100% 4.050 5.670 N KDM2B n/a
3 TRCN0000118441 GACTGCAATAAGGTCACTGAT pLKO.1 5195 CDS 100% 4.950 3.960 N KDM2B n/a
4 TRCN0000234588 CCTGAGGAAGAAGCGGAAATA pLKO_005 3763 CDS 100% 13.200 9.240 N KDM2B n/a
5 TRCN0000234589 CTGAACCACTGCAAGTCTATC pLKO_005 4685 CDS 100% 10.800 7.560 N KDM2B n/a
6 TRCN0000118440 GATGAGCGTGAAAGGTTGTTT pLKO.1 2050 CDS 100% 5.625 3.938 N KDM2B n/a
7 TRCN0000122763 CCACTTCTGCAAGGACATGAA pLKO.1 3238 CDS 100% 4.950 3.465 N KDM2B n/a
8 TRCN0000118438 CCTTCTTCAAACGCTGTGGAA pLKO.1 5226 CDS 100% 2.640 1.848 N KDM2B n/a
9 TRCN0000234587 ATGAGCGTGAAAGGTTGTTTC pLKO_005 2051 CDS 100% 10.800 6.480 N KDM2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.