Transcript: Human XM_011538971.2

PREDICTED: Homo sapiens formin like 3 (FMNL3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMNL3 (91010)
Length:
12793
CDS:
363..3365

Additional Resources:

NCBI RefSeq record:
XM_011538971.2
NBCI Gene record:
FMNL3 (91010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236021 GTCCGATTCATTCGTTCTTAC pLKO_005 3033 CDS 100% 10.800 15.120 N FMNL3 n/a
2 TRCN0000147800 GAACTATCAGTACGGATTCAA pLKO.1 983 CDS 100% 5.625 7.875 N FMNL3 n/a
3 TRCN0000236019 CCTACCCTTTGGGTCTATTTA pLKO_005 7749 3UTR 100% 15.000 12.000 N FMNL3 n/a
4 TRCN0000236022 CCTGTCAGCCATTCGAATTAA pLKO_005 1943 CDS 100% 15.000 12.000 N FMNL3 n/a
5 TRCN0000179511 GAGAGCATCAAGGAGACATAT pLKO.1 1590 CDS 100% 13.200 9.240 N FMNL3 n/a
6 TRCN0000236023 GTAAAGCTGCTGCGGCAATAT pLKO_005 2349 CDS 100% 13.200 9.240 N FMNL3 n/a
7 TRCN0000236020 CATATCTGGACAACGTGTTTG pLKO_005 1396 CDS 100% 10.800 7.560 N FMNL3 n/a
8 TRCN0000120508 GCTGCCTTTGACAATTTCAAA pLKO.1 1140 CDS 100% 0.563 0.394 N Fmnl3 n/a
9 TRCN0000339731 GCTGCCTTTGACAATTTCAAA pLKO_005 1140 CDS 100% 0.563 0.394 N Fmnl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.