Transcript: Human XM_011539001.2

PREDICTED: Homo sapiens BICD family like cargo adaptor 1 (BICDL1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BICDL1 (92558)
Length:
1859
CDS:
64..942

Additional Resources:

NCBI RefSeq record:
XM_011539001.2
NBCI Gene record:
BICDL1 (92558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436798 TGCGGGAAGCAGATCGAGAAA pLKO_005 626 CDS 100% 4.950 3.960 N BICDL1 n/a
2 TRCN0000155513 CCAAAGGCTATTGGATCAGCT pLKO.1 681 CDS 100% 2.640 2.112 N BICDL1 n/a
3 TRCN0000423601 ATGAATTGAGAAGACGATTTG pLKO_005 512 CDS 100% 10.800 7.560 N BICDL1 n/a
4 TRCN0000155216 GCATAAGGAGCTGACAGACAA pLKO.1 465 CDS 100% 4.950 3.465 N BICDL1 n/a
5 TRCN0000156092 CGGAACAGAACCAAAGGCTAT pLKO.1 671 CDS 100% 4.050 2.835 N BICDL1 n/a
6 TRCN0000155289 GAGAGTGATGTGAAGCAGCTA pLKO.1 574 CDS 100% 2.640 1.848 N BICDL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.