Transcript: Human XM_011539424.1

PREDICTED: Homo sapiens dedicator of cytokinesis 1 (DOCK1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK1 (1793)
Length:
6748
CDS:
16..5658

Additional Resources:

NCBI RefSeq record:
XM_011539424.1
NBCI Gene record:
DOCK1 (1793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432991 CCTTAACAAGTACGGAGATAT pLKO_005 3213 CDS 100% 13.200 18.480 N DOCK1 n/a
2 TRCN0000029076 CGTGGCAGATTACGGGAATTT pLKO.1 5481 CDS 100% 13.200 18.480 N DOCK1 n/a
3 TRCN0000029075 CCGAGGTTACACGTTACGAAA pLKO.1 135 CDS 100% 4.950 6.930 N DOCK1 n/a
4 TRCN0000029077 GCCTTGTTTGTGAACCTCAAA pLKO.1 667 CDS 100% 4.950 6.930 N DOCK1 n/a
5 TRCN0000029074 CCGAGCAGTATGAGAACGAAA pLKO.1 3962 CDS 100% 4.950 3.960 N DOCK1 n/a
6 TRCN0000421487 AGTCTTCCTGCGAGCAATTAA pLKO_005 3042 CDS 100% 15.000 10.500 N DOCK1 n/a
7 TRCN0000428917 GGATCGAGAGAACCATATATA pLKO_005 4433 CDS 100% 15.000 10.500 N DOCK1 n/a
8 TRCN0000423533 AGCACGATCTTATCGTCTATA pLKO_005 1703 CDS 100% 13.200 9.240 N DOCK1 n/a
9 TRCN0000029078 CCAGACAATGAATTTGCGAAT pLKO.1 4408 CDS 100% 4.050 2.430 N DOCK1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6538 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.