Transcript: Human XM_011539453.2

PREDICTED: Homo sapiens unc-5 netrin receptor B (UNC5B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC5B (219699)
Length:
3494
CDS:
16..2838

Additional Resources:

NCBI RefSeq record:
XM_011539453.2
NBCI Gene record:
UNC5B (219699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442978 TGTTCACGGGCGAGTCCTATT pLKO_005 2042 CDS 100% 10.800 15.120 N UNC5B n/a
2 TRCN0000061814 CTACGAGATGTATCTACTCAT pLKO.1 1731 CDS 100% 4.950 6.930 N UNC5B n/a
3 TRCN0000061813 CCGTCAACTTTAAGACGGCAA pLKO.1 1268 CDS 100% 0.216 0.302 N UNC5B n/a
4 TRCN0000438199 AGGAGCCGAAACCGCTAATGT pLKO_005 2219 CDS 100% 5.625 4.500 N UNC5B n/a
5 TRCN0000061816 TGTCGGACACTGCCAACTATA pLKO.1 650 CDS 100% 13.200 9.240 N UNC5B n/a
6 TRCN0000421994 AGGTGGAATGGCTCAAGAATG pLKO_005 551 CDS 100% 10.800 7.560 N UNC5B n/a
7 TRCN0000061815 CAGAAGATATGCAACAGCCTA pLKO.1 2590 CDS 100% 2.640 1.848 N UNC5B n/a
8 TRCN0000061817 CCTGGCACATACCCTAGCGAT pLKO.1 1522 CDS 100% 0.880 0.616 N UNC5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.