Transcript: Human XM_011539623.2

PREDICTED: Homo sapiens leucine rich repeat, Ig-like and transmembrane domains 1 (LRIT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRIT1 (26103)
Length:
2486
CDS:
426..2150

Additional Resources:

NCBI RefSeq record:
XM_011539623.2
NBCI Gene record:
LRIT1 (26103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417003 CAACCGCTAACACTTGTTAAG pLKO_005 2302 3UTR 100% 10.800 15.120 N LRIT1 n/a
2 TRCN0000137160 GTTGCCCAAGACCAAGTATGT pLKO.1 1742 CDS 100% 4.950 6.930 N LRIT1 n/a
3 TRCN0000416544 CTCGTTCCAGTGTGGACTTTC pLKO_005 2080 CDS 100% 10.800 8.640 N LRIT1 n/a
4 TRCN0000134448 GTTATCTCCTTGATTGTCACT pLKO.1 1296 CDS 100% 2.640 2.112 N LRIT1 n/a
5 TRCN0000135455 GCTTATCAATGTGGTGGTGAT pLKO.1 1856 CDS 100% 4.050 2.835 N LRIT1 n/a
6 TRCN0000136877 CTTGGCCTTCATTGAGACTGA pLKO.1 944 CDS 100% 2.640 1.848 N LRIT1 n/a
7 TRCN0000136638 GAACACAACTGCCTTCAGTGT pLKO.1 1640 CDS 100% 2.640 1.848 N LRIT1 n/a
8 TRCN0000426067 ACCTGGAGACCGGTATCTTTC pLKO_005 817 CDS 100% 10.800 6.480 N LRIT1 n/a
9 TRCN0000136610 CATCTGCCAAGCCAAGAACTT pLKO.1 1256 CDS 100% 4.950 2.970 N LRIT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.