Transcript: Human XM_011539849.3

PREDICTED: Homo sapiens phospholipase C epsilon 1 (PLCE1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCE1 (51196)
Length:
9139
CDS:
1740..8690

Additional Resources:

NCBI RefSeq record:
XM_011539849.3
NBCI Gene record:
PLCE1 (51196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051067 GCGGATTATTGGAACTCACTA pLKO.1 4738 CDS 100% 4.950 3.960 N PLCE1 n/a
2 TRCN0000289427 GCGGATTATTGGAACTCACTA pLKO_005 4738 CDS 100% 4.950 3.960 N PLCE1 n/a
3 TRCN0000051065 GCTGCAATGTTTGAGGCAAAT pLKO.1 7260 CDS 100% 10.800 7.560 N PLCE1 n/a
4 TRCN0000289426 GCTGCAATGTTTGAGGCAAAT pLKO_005 7260 CDS 100% 10.800 7.560 N PLCE1 n/a
5 TRCN0000051063 CCAACCAATTTACTGATGAAT pLKO.1 8875 3UTR 100% 5.625 3.938 N PLCE1 n/a
6 TRCN0000306746 CCAACCAATTTACTGATGAAT pLKO_005 8875 3UTR 100% 5.625 3.938 N PLCE1 n/a
7 TRCN0000051064 CCATCATTTATCATGGACATA pLKO.1 6082 CDS 100% 4.950 3.465 N PLCE1 n/a
8 TRCN0000289424 CCATCATTTATCATGGACATA pLKO_005 6082 CDS 100% 4.950 3.465 N PLCE1 n/a
9 TRCN0000051066 CCACTTTGTTAGTCAGGAGAT pLKO.1 2704 CDS 100% 4.050 2.835 N PLCE1 n/a
10 TRCN0000289359 CCACTTTGTTAGTCAGGAGAT pLKO_005 2704 CDS 100% 4.050 2.835 N PLCE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.