Transcript: Human XM_011540190.3

PREDICTED: Homo sapiens BicC family RNA binding protein 1 (BICC1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BICC1 (80114)
Length:
5324
CDS:
97..2781

Additional Resources:

NCBI RefSeq record:
XM_011540190.3
NBCI Gene record:
BICC1 (80114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330424 TGCCCGCTGACTAACTGTAAA pLKO_005 2800 3UTR 100% 13.200 18.480 N BICC1 n/a
2 TRCN0000148513 CCCACAATGACAACCACTTAT pLKO.1 2209 CDS 100% 13.200 9.240 N BICC1 n/a
3 TRCN0000330356 CCCACAATGACAACCACTTAT pLKO_005 2209 CDS 100% 13.200 9.240 N BICC1 n/a
4 TRCN0000148433 CCCACTGAAGGTTGTAATGAT pLKO.1 1705 CDS 100% 5.625 3.938 N BICC1 n/a
5 TRCN0000148461 CCACACCTTATGATTCCATCT pLKO.1 1399 CDS 100% 4.050 2.835 N BICC1 n/a
6 TRCN0000353662 CCACACCTTATGATTCCATCT pLKO_005 1399 CDS 100% 4.050 2.835 N BICC1 n/a
7 TRCN0000148514 CCACTTCATCACTTGGAGAAA pLKO.1 1610 CDS 100% 4.950 2.970 N BICC1 n/a
8 TRCN0000330422 CCACTTCATCACTTGGAGAAA pLKO_005 1610 CDS 100% 4.950 2.970 N BICC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.