Transcript: Human XM_011540340.3

PREDICTED: Homo sapiens cadherin related family member 1 (CDHR1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDHR1 (92211)
Length:
2533
CDS:
444..2414

Additional Resources:

NCBI RefSeq record:
XM_011540340.3
NBCI Gene record:
CDHR1 (92211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053572 GTTTGGAAAGAGCGTTCAGAA pLKO.1 2342 CDS 100% 4.950 6.930 N CDHR1 n/a
2 TRCN0000442973 ACCACCCGCCAACATTCTATG pLKO_005 1660 CDS 100% 10.800 7.560 N CDHR1 n/a
3 TRCN0000419825 CTCACGTATACACCCTGAATG pLKO_005 772 CDS 100% 10.800 7.560 N CDHR1 n/a
4 TRCN0000053571 ACGGTCAATGTGGAGGATGTT pLKO.1 1314 CDS 100% 4.950 3.465 N CDHR1 n/a
5 TRCN0000053570 GTCCAAAGTATTAACCTTCAA pLKO.1 1916 CDS 100% 4.950 3.465 N CDHR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.