Transcript: Human XM_011540736.3

PREDICTED: Homo sapiens mindbomb E3 ubiquitin protein ligase 2 (MIB2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIB2 (142678)
Length:
5496
CDS:
1699..5421

Additional Resources:

NCBI RefSeq record:
XM_011540736.3
NBCI Gene record:
MIB2 (142678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034118 GAGGTGCCAAACATCGATGTT pLKO.1 4312 CDS 100% 4.950 6.930 N MIB2 n/a
2 TRCN0000034116 GCGCTAGCTGTGAGAAAGATT pLKO.1 4390 CDS 100% 5.625 4.500 N MIB2 n/a
3 TRCN0000445486 AGGTGGTCGTCAGCAAGAAAC pLKO_005 5153 CDS 100% 10.800 7.560 N MIB2 n/a
4 TRCN0000034114 GCAGTGCTACATGCACAACAA pLKO.1 2838 CDS 100% 4.950 3.465 N MIB2 n/a
5 TRCN0000034115 AGTCCCAAAGTTTCCAGGCAT pLKO.1 2368 CDS 100% 2.640 1.848 N MIB2 n/a
6 TRCN0000438514 GGACAAGGTCAAGTGTCTGCT pLKO_005 3270 CDS 100% 2.640 1.848 N MIB2 n/a
7 TRCN0000431019 GGATGAAGAAGTGCATCAGGT pLKO_005 5129 CDS 100% 2.640 1.848 N MIB2 n/a
8 TRCN0000034117 GAAAGTGTTTGGAGACGGGAA pLKO.1 3657 CDS 100% 2.160 1.512 N MIB2 n/a
9 TRCN0000417095 GCATCTGGCTGCCCTCAACAA pLKO_005 4467 CDS 100% 1.650 1.155 N MIB2 n/a
10 TRCN0000416037 CATCTTCCAGGGAGCGAAGGT pLKO_005 2958 CDS 100% 0.880 0.616 N MIB2 n/a
11 TRCN0000425276 CGACGTGAGCTACACCAACCA pLKO_005 4836 CDS 100% 0.880 0.616 N MIB2 n/a
12 TRCN0000422328 TGTGCCTGGACTACGACCTCT pLKO_005 2813 CDS 100% 0.880 0.616 N MIB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.