Transcript: Human XM_011540779.3

PREDICTED: Homo sapiens solute carrier family 30 member 7 (SLC30A7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC30A7 (148867)
Length:
6022
CDS:
496..1416

Additional Resources:

NCBI RefSeq record:
XM_011540779.3
NBCI Gene record:
SLC30A7 (148867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428615 CAGCTAAGGGATCAGATTTAA pLKO_005 1580 3UTR 100% 15.000 21.000 N SLC30A7 n/a
2 TRCN0000042867 CCTGAACCTCTCTTTCGCTTT pLKO.1 297 5UTR 100% 4.050 5.670 N SLC30A7 n/a
3 TRCN0000042864 GCCATGTCGATCATTGCCATA pLKO.1 848 CDS 100% 4.050 5.670 N SLC30A7 n/a
4 TRCN0000079628 GCCAGCATAGAAATGTACCAT pLKO.1 2040 3UTR 100% 3.000 4.200 N Slc30a7 n/a
5 TRCN0000419631 AGAGAATCTGTTGGAATATTA pLKO_005 1144 CDS 100% 15.000 10.500 N SLC30A7 n/a
6 TRCN0000425371 ACACAGTCATTCCCTCTTTAA pLKO_005 804 CDS 100% 13.200 9.240 N SLC30A7 n/a
7 TRCN0000042863 GCAGATCCTATCTGTTCAATT pLKO.1 1081 CDS 100% 13.200 9.240 N SLC30A7 n/a
8 TRCN0000042866 GACTTTATGTTCTGACGTTTA pLKO.1 1266 CDS 100% 10.800 7.560 N SLC30A7 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2342 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2342 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.