Transcript: Human XM_011540824.2

PREDICTED: Homo sapiens solute carrier family 2 member 7 (SLC2A7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A7 (155184)
Length:
1739
CDS:
40..1593

Additional Resources:

NCBI RefSeq record:
XM_011540824.2
NBCI Gene record:
SLC2A7 (155184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072817 CGCAACATTCATGGACGGGAA pLKO.1 231 CDS 100% 2.160 1.728 N SLC2A7 n/a
2 TRCN0000072814 CTCGGCATCATCTGTGTCTTT pLKO.1 1180 CDS 100% 4.950 3.465 N SLC2A7 n/a
3 TRCN0000072816 CTACAACCTCTCTGTGGTCAA pLKO.1 156 CDS 100% 4.050 2.835 N SLC2A7 n/a
4 TRCN0000072815 CGTCAACATAGTGATGACCAT pLKO.1 1026 CDS 100% 2.640 1.848 N SLC2A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.