Transcript: Human XM_011540870.3

PREDICTED: Homo sapiens E2F transcription factor 2 (E2F2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
E2F2 (1870)
Length:
1656
CDS:
122..1174

Additional Resources:

NCBI RefSeq record:
XM_011540870.3
NBCI Gene record:
E2F2 (1870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540870.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013799 GCCTATGTGACTTACCAGGAT pLKO.1 863 CDS 100% 2.640 3.696 N E2F2 n/a
2 TRCN0000013801 CCGAGGGCCAAGTTGTGCGAT pLKO.1 330 CDS 100% 0.000 0.000 N E2F2 n/a
3 TRCN0000423524 TCCGTGCTGTTGGCAACTTTA pLKO_005 885 CDS 100% 13.200 10.560 N E2F2 n/a
4 TRCN0000424684 GAGGACAACCTGCAGATATAT pLKO_005 971 CDS 100% 15.000 10.500 N E2F2 n/a
5 TRCN0000013800 GCAGACAGTGATTGCCGTCAA pLKO.1 910 CDS 100% 4.050 2.835 N E2F2 n/a
6 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1559 3UTR 100% 4.950 2.475 Y GJD4 n/a
7 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1559 3UTR 100% 4.950 2.475 Y C9orf85 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1443 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540870.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.