Transcript: Human XM_011540871.2

PREDICTED: Homo sapiens E2F transcription factor 2 (E2F2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
E2F2 (1870)
Length:
4671
CDS:
494..1219

Additional Resources:

NCBI RefSeq record:
XM_011540871.2
NBCI Gene record:
E2F2 (1870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013799 GCCTATGTGACTTACCAGGAT pLKO.1 647 CDS 100% 2.640 3.696 N E2F2 n/a
2 TRCN0000423524 TCCGTGCTGTTGGCAACTTTA pLKO_005 669 CDS 100% 13.200 10.560 N E2F2 n/a
3 TRCN0000429832 GTACGGGTGAGGAGTGGATAA pLKO_005 1391 3UTR 100% 10.800 8.640 N E2F2 n/a
4 TRCN0000424684 GAGGACAACCTGCAGATATAT pLKO_005 755 CDS 100% 15.000 10.500 N E2F2 n/a
5 TRCN0000013798 CCACTCTATAAGCAGGGCTAA pLKO.1 2974 3UTR 100% 4.050 2.835 N E2F2 n/a
6 TRCN0000013800 GCAGACAGTGATTGCCGTCAA pLKO.1 694 CDS 100% 4.050 2.835 N E2F2 n/a
7 TRCN0000013802 CAGCGATCTCTTCGACTCCTA pLKO.1 1171 CDS 100% 2.640 1.848 N E2F2 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3785 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.