Transcript: Human XM_011541091.2

PREDICTED: Homo sapiens calmodulin binding transcription activator 1 (CAMTA1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMTA1 (23261)
Length:
3245
CDS:
72..3008

Additional Resources:

NCBI RefSeq record:
XM_011541091.2
NBCI Gene record:
CAMTA1 (23261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158023 CACAAGTGTAACAGCGCCAAA pLKO.1 897 CDS 100% 4.050 5.670 N CAMTA1 n/a
2 TRCN0000156461 CCCTAAGACAAGACCACAGAA pLKO.1 362 CDS 100% 4.950 3.465 N CAMTA1 n/a
3 TRCN0000150891 GAATGGCTCAATGATACTCTA pLKO.1 380 CDS 100% 4.950 3.465 N CAMTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.