Transcript: Human XM_011541166.2

PREDICTED: Homo sapiens mechanistic target of rapamycin kinase (MTOR), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTOR (2475)
Length:
4983
CDS:
122..4894

Additional Resources:

NCBI RefSeq record:
XM_011541166.2
NBCI Gene record:
MTOR (2475)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145082 GGTGATGGCCTGGACAACCA pXPR_003 TGG 2911 61% 19 1.2005 MTOR MTOR 76782
2 BRDN0001145868 TCAGGAAATGATCCGCACAG pXPR_003 TGG 1817 38% 12 0.6172 MTOR MTOR 76784
3 BRDN0001147813 GTGAAGGGGGTAATGTGACG pXPR_003 AGG 933 20% 7 -0.2499 MTOR MTOR 76783
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199323 CCCGGATCATTCACCCTATTG pLKO.1 3579 CDS 100% 10.800 15.120 N MTOR n/a
2 TRCN0000344491 CCCGGATCATTCACCCTATTG pLKO_005 3579 CDS 100% 10.800 15.120 N MTOR n/a
3 TRCN0000038676 CCTCCTATTGTTAAGTTGTTT pLKO.1 3467 CDS 100% 5.625 7.875 N MTOR n/a
4 TRCN0000038678 GCATGGAAGAATACACCTGTA pLKO.1 4704 CDS 100% 4.050 5.670 N MTOR n/a
5 TRCN0000221545 GCCTTGTTTGTGGCTCTGAAT pLKO.1 2204 CDS 100% 4.950 3.960 N MTOR n/a
6 TRCN0000332887 GCCTTGTTTGTGGCTCTGAAT pLKO_005 2204 CDS 100% 4.950 3.960 N MTOR n/a
7 TRCN0000360707 ATGCTGTCCCTGGTCCTTATG pLKO_005 1745 CDS 100% 10.800 7.560 N Mtor n/a
8 TRCN0000221543 GCAACCCTTCTTTGACAACAT pLKO.1 682 CDS 100% 4.950 3.465 N MTOR n/a
9 TRCN0000363722 GCAACCCTTCTTTGACAACAT pLKO_005 682 CDS 100% 4.950 3.465 N MTOR n/a
10 TRCN0000038675 CCTGGCAACAATAGGAGAATT pLKO.1 2515 CDS 100% 0.000 0.000 N MTOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.