Transcript: Human XM_011541226.2

PREDICTED: Homo sapiens phosphoglycerate dehydrogenase (PHGDH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHGDH (26227)
Length:
2089
CDS:
88..1911

Additional Resources:

NCBI RefSeq record:
XM_011541226.2
NBCI Gene record:
PHGDH (26227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233029 CAGGACTGTGAAGGCCTTATT pLKO_005 223 CDS 100% 13.200 18.480 N PHGDH n/a
2 TRCN0000221864 GCTTCGATGAAGGACGGCAAA pLKO.1 685 CDS 100% 4.050 5.670 N PHGDH n/a
3 TRCN0000255351 TCCTTTGGGATGAAGACTATA pLKO_005 805 CDS 100% 13.200 9.240 N PHGDH n/a
4 TRCN0000233032 CAATGCTGCCTACCATGATTG pLKO_005 1736 CDS 100% 10.800 7.560 N PHGDH n/a
5 TRCN0000233033 CCCACCCACTGTGATCAATAG pLKO_005 1957 3UTR 100% 10.800 7.560 N PHGDH n/a
6 TRCN0000233030 CTTCGATGAAGGACGGCAAAT pLKO_005 686 CDS 100% 10.800 7.560 N PHGDH n/a
7 TRCN0000221863 AGGTGATAACACAGGGAACAT pLKO.1 1373 CDS 100% 4.950 3.465 N PHGDH n/a
8 TRCN0000221865 CAGACTTCACTGGTGTCAGAT pLKO.1 1795 CDS 100% 4.950 3.465 N PHGDH n/a
9 TRCN0000221862 CGCAGAACTCACTTGTGGAAT pLKO.1 405 CDS 100% 4.950 3.465 N PHGDH n/a
10 TRCN0000221861 CTTAGCAAAGAGGAGCTGATA pLKO.1 193 CDS 100% 4.950 3.465 N PHGDH n/a
11 TRCN0000233031 ACGCTAAGCTGCTGGTGAAAG pLKO_005 1484 CDS 100% 10.800 6.480 N PHGDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.