Transcript: Human XM_011541318.2

PREDICTED: Homo sapiens heparan sulfate proteoglycan 2 (HSPG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSPG2 (3339)
Length:
14812
CDS:
16..13740

Additional Resources:

NCBI RefSeq record:
XM_011541318.2
NBCI Gene record:
HSPG2 (3339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413420 GCTGCCAAGGGACGTATATAT pLKO_005 10940 CDS 100% 15.000 21.000 N HSPG2 n/a
2 TRCN0000073568 CGGTCAAGATTGAGTCCTCAT pLKO.1 6719 CDS 100% 4.050 5.670 N HSPG2 n/a
3 TRCN0000073570 GCTGCAAGGTAACAACATCAT pLKO.1 3162 CDS 100% 4.950 3.465 N HSPG2 n/a
4 TRCN0000073571 GCTGGACACATTCGTACCTTT pLKO.1 155 CDS 100% 4.950 3.465 N HSPG2 n/a
5 TRCN0000073569 CCAGGCTATCATCACATGGTA pLKO.1 8535 CDS 100% 3.000 2.100 N HSPG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.