Transcript: Human XM_011541580.1

PREDICTED: Homo sapiens peroxisomal biogenesis factor 14 (PEX14), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PEX14 (5195)
Length:
1797
CDS:
22..1026

Additional Resources:

NCBI RefSeq record:
XM_011541580.1
NBCI Gene record:
PEX14 (5195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160181 CGAACTCAAGTCCGAAATTAA pLKO.1 522 CDS 100% 15.000 10.500 N PEX14 n/a
2 TRCN0000322607 CGAACTCAAGTCCGAAATTAA pLKO_005 522 CDS 100% 15.000 10.500 N PEX14 n/a
3 TRCN0000322678 ATCATGGCAGGCATTGCATTT pLKO_005 235 CDS 100% 10.800 7.560 N PEX14 n/a
4 TRCN0000322609 TTGCCACGGCAGTGAAGTTTC pLKO_005 107 CDS 100% 10.800 7.560 N PEX14 n/a
5 TRCN0000247172 AGGCTCCCGATGGCGAGATTA pLKO_005 198 CDS 100% 4.400 3.080 N Pex14 n/a
6 TRCN0000322608 CTGAGGATGGCATCTAGTGTG pLKO_005 1050 3UTR 100% 4.050 2.835 N PEX14 n/a
7 TRCN0000162937 GCAGGCATTGCATTTGGCTTT pLKO.1 241 CDS 100% 4.050 2.835 N PEX14 n/a
8 TRCN0000158465 CCAGAATATCAACGAACTCAA pLKO.1 510 CDS 100% 4.950 2.970 N PEX14 n/a
9 TRCN0000162732 CCCAGAATATCAACGAACTCA pLKO.1 509 CDS 100% 3.000 1.800 N PEX14 n/a
10 TRCN0000322675 CCCAGAATATCAACGAACTCA pLKO_005 509 CDS 100% 3.000 1.800 N PEX14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.