Transcript: Human XM_011541766.2

PREDICTED: Homo sapiens NDC1 transmembrane nucleoporin (NDC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDC1 (55706)
Length:
4642
CDS:
137..2158

Additional Resources:

NCBI RefSeq record:
XM_011541766.2
NBCI Gene record:
NDC1 (55706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072710 GCAATACAAGTTCTTGCGTTT pLKO.1 727 CDS 100% 4.050 5.670 N NDC1 n/a
2 TRCN0000286641 GCAATACAAGTTCTTGCGTTT pLKO_005 727 CDS 100% 4.050 5.670 N NDC1 n/a
3 TRCN0000072712 CGACACTACCAGCTATCCTTA pLKO.1 1890 CDS 100% 4.950 3.960 N NDC1 n/a
4 TRCN0000216034 CAGATGCCCAAATGCATATTT pLKO.1 1800 CDS 100% 15.000 10.500 N Ndc1 n/a
5 TRCN0000293997 CGCAAAGTCCTCAGCTAATAA pLKO_005 1548 CDS 100% 15.000 10.500 N NDC1 n/a
6 TRCN0000072711 CCTGTATAGTTCCTATGTAAT pLKO.1 325 CDS 100% 13.200 9.240 N NDC1 n/a
7 TRCN0000286581 CCTGTATAGTTCCTATGTAAT pLKO_005 325 CDS 100% 13.200 9.240 N NDC1 n/a
8 TRCN0000072709 CGCACTTAGTAGCAGCATCAT pLKO.1 1839 CDS 100% 4.950 3.465 N NDC1 n/a
9 TRCN0000286582 CGCACTTAGTAGCAGCATCAT pLKO_005 1839 CDS 100% 4.950 3.465 N NDC1 n/a
10 TRCN0000072708 GTGTTCATTACACTGCTGATA pLKO.1 2175 3UTR 100% 4.950 3.465 N NDC1 n/a
11 TRCN0000286583 GTGTTCATTACACTGCTGATA pLKO_005 2175 3UTR 100% 4.950 3.465 N NDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.