Transcript: Human XM_011541879.2

PREDICTED: Homo sapiens DLG associated protein 3 (DLGAP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLGAP3 (58512)
Length:
9057
CDS:
2155..5094

Additional Resources:

NCBI RefSeq record:
XM_011541879.2
NBCI Gene record:
DLGAP3 (58512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245790 CGGAGGGAGTTCCACTCTATT pLKO_005 4108 CDS 100% 13.200 9.240 N DLGAP3 n/a
2 TRCN0000245792 AGGCCAAAGCCAGGACTTATC pLKO_005 3230 CDS 100% 10.800 7.560 N DLGAP3 n/a
3 TRCN0000245793 CTACACTCCTGGATCAGTTTG pLKO_005 2510 CDS 100% 10.800 7.560 N DLGAP3 n/a
4 TRCN0000028214 CGAGTGGTTCATCAAGATGCT pLKO.1 4539 CDS 100% 2.640 1.848 N Dlgap3 n/a
5 TRCN0000245791 CAAGGTTCAAGCGCTCCAATA pLKO_005 4160 CDS 100% 10.800 6.480 N DLGAP3 n/a
6 TRCN0000245789 CACCATCTCTGCCATTCTTTC pLKO_005 5378 3UTR 100% 10.800 6.480 N DLGAP3 n/a
7 TRCN0000028261 AGCCAGGACTTATCACTATTT pLKO.1 3237 CDS 100% 13.200 9.240 N Dlgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.