Transcript: Human XM_011542053.3

PREDICTED: Homo sapiens transcription elongation factor A3 (TCEA3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCEA3 (6920)
Length:
1323
CDS:
118..1212

Additional Resources:

NCBI RefSeq record:
XM_011542053.3
NBCI Gene record:
TCEA3 (6920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006639 CCATCCAGCTACTACAGACAA pLKO.1 233 CDS 100% 4.950 6.930 N TCEA3 n/a
2 TRCN0000318597 CCATCCAGCTACTACAGACAA pLKO_005 233 CDS 100% 4.950 6.930 N TCEA3 n/a
3 TRCN0000006643 CGCAGGGCTTATAGCCAAGAT pLKO.1 906 CDS 100% 4.950 6.930 N TCEA3 n/a
4 TRCN0000318715 CGCAGGGCTTATAGCCAAGAT pLKO_005 906 CDS 100% 4.950 6.930 N TCEA3 n/a
5 TRCN0000006642 GACGATGATTACAAGGACTAT pLKO.1 721 CDS 100% 4.950 3.465 N TCEA3 n/a
6 TRCN0000318669 GACGATGATTACAAGGACTAT pLKO_005 721 CDS 100% 4.950 3.465 N TCEA3 n/a
7 TRCN0000006640 GCCCATGACTACCTTTGTCTT pLKO.1 1107 CDS 100% 4.950 3.465 N TCEA3 n/a
8 TRCN0000318671 GCCCATGACTACCTTTGTCTT pLKO_005 1107 CDS 100% 4.950 3.465 N TCEA3 n/a
9 TRCN0000006641 GCTTGAGTGTTCAGACTGGAA pLKO.1 423 CDS 100% 2.640 1.848 N TCEA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.