Transcript: Human XM_011542225.3

PREDICTED: Homo sapiens capping actin protein of muscle Z-line subunit alpha 1 (CAPZA1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPZA1 (829)
Length:
723
CDS:
71..685

Additional Resources:

NCBI RefSeq record:
XM_011542225.3
NBCI Gene record:
CAPZA1 (829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294291 TGACGTTCGGCTACTACTTAA pLKO_005 172 CDS 100% 13.200 18.480 N CAPZA1 n/a
2 TRCN0000116910 GATGGGCAACAGACTATTATT pLKO.1 515 CDS 100% 15.000 12.000 N CAPZA1 n/a
3 TRCN0000286936 GATGGGCAACAGACTATTATT pLKO_005 515 CDS 100% 15.000 12.000 N CAPZA1 n/a
4 TRCN0000116909 CCTATGTGAAAGACCATTATT pLKO.1 459 CDS 100% 15.000 10.500 N CAPZA1 n/a
5 TRCN0000298259 CCTATGTGAAAGACCATTATT pLKO_005 459 CDS 100% 15.000 10.500 N CAPZA1 n/a
6 TRCN0000116911 CCAGTATAACATGGATCAGTT pLKO.1 235 CDS 100% 4.950 3.465 N CAPZA1 n/a
7 TRCN0000116908 GCTGCTAAATTCATCACTCAT pLKO.1 119 CDS 100% 4.950 3.465 N CAPZA1 n/a
8 TRCN0000286935 GCTGCTAAATTCATCACTCAT pLKO_005 119 CDS 100% 4.950 3.465 N CAPZA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.