Transcript: Human XM_011542441.3

PREDICTED: Homo sapiens TNF receptor superfamily member 8 (TNFRSF8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFRSF8 (943)
Length:
3749
CDS:
283..2067

Additional Resources:

NCBI RefSeq record:
XM_011542441.3
NBCI Gene record:
TNFRSF8 (943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421794 GCGGAAGAGCGAGGGTTAATG pLKO_005 1651 CDS 100% 4.400 6.160 N TNFRSF8 n/a
2 TRCN0000436223 ATGTCGACCTGGCATGATCTG pLKO_005 1128 CDS 100% 4.050 3.240 N TNFRSF8 n/a
3 TRCN0000058834 CACCAATAACAAGATTGAGAA pLKO.1 1806 CDS 100% 4.950 3.465 N TNFRSF8 n/a
4 TRCN0000436602 CATGAAGGCTGACACCGTGAT pLKO_005 1836 CDS 100% 4.050 2.835 N TNFRSF8 n/a
5 TRCN0000058837 CCCTTCGAGGACACCTGTCAT pLKO.1 352 CDS 100% 1.650 1.155 N TNFRSF8 n/a
6 TRCN0000058833 CCAAGCTAGAGCTTGTGGATT pLKO.1 1574 CDS 100% 0.495 0.347 N TNFRSF8 n/a
7 TRCN0000058836 GCCAGTGCTCTTCTGGGTGAT pLKO.1 1437 CDS 100% 1.350 0.810 N TNFRSF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.