Transcript: Human XM_011542882.2

PREDICTED: Homo sapiens neurexophilin and PC-esterase domain family member 4 (NXPE4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NXPE4 (54827)
Length:
1956
CDS:
182..1609

Additional Resources:

NCBI RefSeq record:
XM_011542882.2
NBCI Gene record:
NXPE4 (54827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419931 GTAGTCGGAAATCAGATTAAT pLKO_005 1565 CDS 100% 15.000 21.000 N NXPE4 n/a
2 TRCN0000415947 ATCTCAGTGTGAGTATCATTG pLKO_005 1488 CDS 100% 10.800 15.120 N NXPE4 n/a
3 TRCN0000131022 CATTGTTATTTCCCTGGGCCA pLKO.1 1264 CDS 100% 0.540 0.756 N NXPE4 n/a
4 TRCN0000147542 GACCTATTCAGTCAAAGAGAT pLKO.1 1192 CDS 100% 4.950 3.960 N NXPE4 n/a
5 TRCN0000147161 CCTGGGATATAACAATTGCAT pLKO.1 1512 CDS 100% 3.000 2.400 N NXPE4 n/a
6 TRCN0000431074 TAATCTGGGCTTCCACTTAAA pLKO_005 1774 3UTR 100% 13.200 9.240 N NXPE4 n/a
7 TRCN0000129361 GCTGATCCATAAGCCACCAAT pLKO.1 1733 3UTR 100% 4.950 3.465 N NXPE4 n/a
8 TRCN0000131021 CTGAAGTCAGTGGATCTGCAT pLKO.1 1076 CDS 100% 2.640 1.848 N NXPE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.