Transcript: Human XM_011543030.3

PREDICTED: Homo sapiens kirre like nephrin family adhesion molecule 3 (KIRREL3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIRREL3 (84623)
Length:
3525
CDS:
86..2440

Additional Resources:

NCBI RefSeq record:
XM_011543030.3
NBCI Gene record:
KIRREL3 (84623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415984 CAAGGAGCAAGGTTCGGAAAT pLKO_005 1645 CDS 100% 10.800 15.120 N KIRREL3 n/a
2 TRCN0000005582 CGACTTCCAGACCATCTACAA pLKO.1 1576 CDS 100% 4.950 6.930 N KIRREL3 n/a
3 TRCN0000432955 ACAGCCAGTGACGCTACTTTG pLKO_005 289 CDS 100% 10.800 8.640 N KIRREL3 n/a
4 TRCN0000417851 GAGGACAACGTCGTCACTTTC pLKO_005 890 CDS 100% 10.800 7.560 N KIRREL3 n/a
5 TRCN0000005579 CCGTTCCCAGAGAAATCTCAA pLKO.1 1786 CDS 100% 4.950 3.465 N KIRREL3 n/a
6 TRCN0000005580 CCTCTCAAGTTACCCACAGTA pLKO.1 379 CDS 100% 4.950 3.465 N KIRREL3 n/a
7 TRCN0000005583 CTCCATCATCTGGTTGCGAAA pLKO.1 640 CDS 100% 4.050 2.835 N KIRREL3 n/a
8 TRCN0000005581 CGGAGAATGAATGAAGGCCAA pLKO.1 221 CDS 100% 2.160 1.512 N KIRREL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.