Transcript: Human XM_011543247.2

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 19 (ADAMTS19), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS19 (171019)
Length:
4544
CDS:
598..3081

Additional Resources:

NCBI RefSeq record:
XM_011543247.2
NBCI Gene record:
ADAMTS19 (171019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418785 TGGCTATCAGGGATTAGATAT pLKO_005 1668 CDS 100% 13.200 18.480 N ADAMTS19 n/a
2 TRCN0000046920 GCAGGTCAATCTTCGTGTGAT pLKO.1 516 5UTR 100% 4.950 6.930 N ADAMTS19 n/a
3 TRCN0000046919 CCGTTAGATGTACCAACCCAA pLKO.1 2636 CDS 100% 2.640 3.696 N ADAMTS19 n/a
4 TRCN0000436643 GTATACTGACTTAGCATAATA pLKO_005 3439 3UTR 100% 15.000 10.500 N ADAMTS19 n/a
5 TRCN0000435331 GTCATTACTGTGGTATCATTT pLKO_005 225 5UTR 100% 13.200 9.240 N ADAMTS19 n/a
6 TRCN0000046922 GCAATGAGCAACCATGTCAAA pLKO.1 2369 CDS 100% 4.950 3.465 N ADAMTS19 n/a
7 TRCN0000046918 GCAAGGAAGATTTGGAAAGAT pLKO.1 986 CDS 100% 5.625 3.375 N ADAMTS19 n/a
8 TRCN0000046921 GCTCCTGTTTCAGGATCAGAA pLKO.1 2106 CDS 100% 4.950 2.970 N ADAMTS19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.