Transcript: Human XM_011543448.1

PREDICTED: Homo sapiens family with sequence similarity 13 member B (FAM13B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM13B (51306)
Length:
5406
CDS:
328..3141

Additional Resources:

NCBI RefSeq record:
XM_011543448.1
NBCI Gene record:
FAM13B (51306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047839 CGCCACGTTGTGGACTATATT pLKO.1 454 CDS 100% 15.000 21.000 N FAM13B n/a
2 TRCN0000230822 CGCCACGTTGTGGACTATATT pLKO_005 454 CDS 100% 15.000 21.000 N FAM13B n/a
3 TRCN0000352513 CGCCACGTTGTGGACTATATT pLKO_005 454 CDS 100% 15.000 21.000 N Fam13b n/a
4 TRCN0000230825 GGTGACCTCGCTTAGTATATT pLKO_005 3791 3UTR 100% 15.000 21.000 N FAM13B n/a
5 TRCN0000218201 TGCCAATCCAAAGGTATTAAA pLKO_005 2196 CDS 100% 15.000 21.000 N FAM13B n/a
6 TRCN0000230823 ACGGCAACAAGCACCCATATA pLKO_005 1165 CDS 100% 13.200 9.240 N FAM13B n/a
7 TRCN0000047838 GCAGCTTCTATGCCTGAATTA pLKO.1 2905 CDS 100% 13.200 9.240 N FAM13B n/a
8 TRCN0000047840 CCTCAGCTATTAGCCTTCTTA pLKO.1 602 CDS 100% 5.625 3.938 N FAM13B n/a
9 TRCN0000047841 GCCAACACTGAATCAGAAGTA pLKO.1 1651 CDS 100% 4.950 3.465 N FAM13B n/a
10 TRCN0000047842 CCATCTAAAGAAGCAACCCTT pLKO.1 2404 CDS 100% 2.640 1.848 N FAM13B n/a
11 TRCN0000230824 TACCCAGTCTGTAGGTATATT pLKO_005 1500 CDS 100% 0.000 0.000 N FAM13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.