Transcript: Human XM_011543492.2

PREDICTED: Homo sapiens protein geranylgeranyltransferase type I subunit beta (PGGT1B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGGT1B (5229)
Length:
1877
CDS:
403..1260

Additional Resources:

NCBI RefSeq record:
XM_011543492.2
NBCI Gene record:
PGGT1B (5229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337197 AGACGACTTAAGCCGAGTAAA pLKO_005 441 CDS 100% 13.200 18.480 N PGGT1B n/a
2 TRCN0000189203 GCCTGTCACTAATGGAGGAAA pLKO.1 1016 CDS 100% 4.950 3.960 N PGGT1B n/a
3 TRCN0000337198 TTATCATGGAAGACCTAATAA pLKO_005 810 CDS 100% 15.000 10.500 N PGGT1B n/a
4 TRCN0000187927 GACGACTTAAGCCGAGTAAAT pLKO.1 442 CDS 100% 13.200 9.240 N PGGT1B n/a
5 TRCN0000337131 GGATAAAGAGGTGGTGTATAA pLKO_005 773 CDS 100% 13.200 9.240 N PGGT1B n/a
6 TRCN0000202578 CCAATACACTAACTTTGAGAA pLKO.1 891 CDS 100% 4.950 3.465 N PGGT1B n/a
7 TRCN0000337199 TGGTGAACAAAGATGATATAA pLKO_005 226 5UTR 100% 15.000 9.000 N PGGT1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.