Transcript: Human XM_011543552.2

PREDICTED: Homo sapiens transmembrane protein 232 (TMEM232), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM232 (642987)
Length:
5730
CDS:
863..2836

Additional Resources:

NCBI RefSeq record:
XM_011543552.2
NBCI Gene record:
TMEM232 (642987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269461 ACTTAGGCTTCAACCATATTT pLKO_005 1438 CDS 100% 15.000 21.000 N TMEM232 n/a
2 TRCN0000284017 GCTAGCAAAGATTGGCTATTT pLKO_005 1354 CDS 100% 13.200 18.480 N TMEM232 n/a
3 TRCN0000269463 TCCTGAAAGCCTCGGAAATTA pLKO_005 1527 CDS 100% 15.000 10.500 N TMEM232 n/a
4 TRCN0000270199 CCAAGACTACATCTAGTATTT pLKO_005 3075 3UTR 100% 13.200 9.240 N TMEM232 n/a
5 TRCN0000269407 TAGTCTGGACTGGTTACTATG pLKO_005 2148 CDS 100% 10.800 7.560 N TMEM232 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 283 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 283 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.