Transcript: Human XM_011544276.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 13 (TTC13), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC13 (79573)
Length:
2525
CDS:
177..1868

Additional Resources:

NCBI RefSeq record:
XM_011544276.2
NBCI Gene record:
TTC13 (79573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133879 CCAACGTTAAGATCGATGATT pLKO.1 1800 CDS 100% 5.625 7.875 N TTC13 n/a
2 TRCN0000133800 CAGAAACGTTTCCAACGTTAA pLKO.1 1789 CDS 100% 1.080 1.512 N TTC13 n/a
3 TRCN0000430387 TAATGAAGTGTGCCAGTATAT pLKO_005 434 CDS 100% 13.200 10.560 N TTC13 n/a
4 TRCN0000137709 GCCTTTAGCAAAGTCGCCAAA pLKO.1 1713 CDS 100% 4.050 3.240 N TTC13 n/a
5 TRCN0000253414 CTGATGCTGTCTGCAACTTAA pLKO_005 1519 CDS 100% 13.200 9.240 N Ttc13 n/a
6 TRCN0000414990 ATGGATTCACAATCACGATTA pLKO_005 1348 CDS 100% 10.800 7.560 N TTC13 n/a
7 TRCN0000133801 CATATAGAGAACTGGGCAATT pLKO.1 262 CDS 100% 10.800 7.560 N TTC13 n/a
8 TRCN0000430296 GTTGACTTTATTGATGCATAT pLKO_005 225 CDS 100% 10.800 7.560 N TTC13 n/a
9 TRCN0000134765 GCCCTGAGTATCTTAAAGTAA pLKO.1 553 CDS 100% 5.625 3.938 N TTC13 n/a
10 TRCN0000138245 CCACGGAAGAAAGGACACAAT pLKO.1 1414 CDS 100% 4.950 3.465 N TTC13 n/a
11 TRCN0000134467 GCAGTTAAATGGAGAAGGATT pLKO.1 990 CDS 100% 4.950 3.465 N TTC13 n/a
12 TRCN0000137854 GCTACTTGACTTGGAGGGAAA pLKO.1 2067 3UTR 100% 4.050 2.835 N TTC13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.