Transcript: Human XM_011544389.2

PREDICTED: Homo sapiens cholinergic receptor nicotinic alpha 2 subunit (CHRNA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRNA2 (1135)
Length:
3920
CDS:
1057..2052

Additional Resources:

NCBI RefSeq record:
XM_011544389.2
NBCI Gene record:
CHRNA2 (1135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436304 CCATCCAGCTTAACGTTATTG pLKO_005 2197 3UTR 100% 13.200 18.480 N CHRNA2 n/a
2 TRCN0000061046 GCCCAACACTTCAGACGTGGT pLKO.1 829 5UTR 100% 0.720 1.008 N CHRNA2 n/a
3 TRCN0000445085 AGGAGTGGAGCGACTACAAAC pLKO_005 936 5UTR 100% 10.800 7.560 N CHRNA2 n/a
4 TRCN0000061044 CGTTCCTAGCTGGAATGATCT pLKO.1 2030 CDS 100% 4.950 3.465 N CHRNA2 n/a
5 TRCN0000438470 ATCGCTCAGCTCATCGATGTG pLKO_005 872 5UTR 100% 4.050 2.835 N CHRNA2 n/a
6 TRCN0000414672 CTAAGTGACAGAAGGGTCAAC pLKO_005 2354 3UTR 100% 4.050 2.835 N CHRNA2 n/a
7 TRCN0000061047 CAACATCACATCTCTCAGGGT pLKO.1 982 5UTR 100% 0.660 0.462 N CHRNA2 n/a
8 TRCN0000061045 CTGGAAGGTGTGCACTACATT pLKO.1 1870 CDS 100% 5.625 3.375 N CHRNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.