Transcript: Human XM_011544416.2

PREDICTED: Homo sapiens cell division cycle associated 2 (CDCA2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDCA2 (157313)
Length:
6966
CDS:
238..3396

Additional Resources:

NCBI RefSeq record:
XM_011544416.2
NBCI Gene record:
CDCA2 (157313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370538 AGACTGGGTTCAGGTTATTTC pLKO_005 2155 CDS 100% 13.200 18.480 N CDCA2 n/a
2 TRCN0000135053 CGGAAGTGTTTGATGAATCTT pLKO.1 1526 CDS 100% 5.625 7.875 N CDCA2 n/a
3 TRCN0000138065 GCCGTTCTCAGTTCTCCTAAT pLKO.1 1720 CDS 100% 10.800 8.640 N CDCA2 n/a
4 TRCN0000135143 CCGTTCTCAGTTCTCCTAATA pLKO.1 1721 CDS 100% 13.200 9.240 N CDCA2 n/a
5 TRCN0000376596 TATTCTGATGGTCGAAGTTTA pLKO_005 2830 CDS 100% 13.200 9.240 N CDCA2 n/a
6 TRCN0000365361 TGGGACTCATCCGAGCTTAAT pLKO_005 1386 CDS 100% 13.200 9.240 N CDCA2 n/a
7 TRCN0000370537 CTGTGGCAAGAGGGAAAGTAA pLKO_005 3416 3UTR 100% 5.625 3.938 N CDCA2 n/a
8 TRCN0000138544 CCACAGTAACCGTAGAGCAAT pLKO.1 410 CDS 100% 4.950 3.465 N CDCA2 n/a
9 TRCN0000135893 GCAAACCTTTCAGAGGAGAAA pLKO.1 2958 CDS 100% 4.950 3.465 N CDCA2 n/a
10 TRCN0000370536 ACATTTCCTGCAGAGTCTGTG pLKO_005 3400 3UTR 100% 4.050 2.835 N CDCA2 n/a
11 TRCN0000365429 GAACCACTTCAAGTATCATTT pLKO_005 1699 CDS 100% 13.200 7.920 N CDCA2 n/a
12 TRCN0000370535 TATGCATCAAGGCTATGATAA pLKO_005 2262 CDS 100% 13.200 7.920 N CDCA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.