Transcript: Human XM_011544422.2

PREDICTED: Homo sapiens establishment of sister chromatid cohesion N-acetyltransferase 2 (ESCO2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESCO2 (157570)
Length:
2142
CDS:
85..1860

Additional Resources:

NCBI RefSeq record:
XM_011544422.2
NBCI Gene record:
ESCO2 (157570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416815 ATCTGTTTCCATCACCTAATA pLKO_005 158 CDS 100% 13.200 9.240 N ESCO2 n/a
2 TRCN0000134753 GCAAGTCTTGTGGTATGATAT pLKO.1 1250 CDS 100% 13.200 9.240 N ESCO2 n/a
3 TRCN0000138044 CCACAGGTTTCTGGAAGGAAT pLKO.1 1317 CDS 100% 4.950 3.465 N ESCO2 n/a
4 TRCN0000134063 GTTGGGTGTTTAATTGCAGAA pLKO.1 1549 CDS 100% 4.050 2.835 N ESCO2 n/a
5 TRCN0000136946 CCTGAAGATGAAATGCAGCAT pLKO.1 1285 CDS 100% 2.640 1.584 N ESCO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.