Transcript: Human XM_011544453.1

PREDICTED: Homo sapiens tripartite motif containing 35 (TRIM35), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM35 (23087)
Length:
4258
CDS:
563..1594

Additional Resources:

NCBI RefSeq record:
XM_011544453.1
NBCI Gene record:
TRIM35 (23087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033780 CTTGCATCTGTGGAATCTGTA pLKO.1 998 CDS 100% 4.950 3.465 N TRIM35 n/a
2 TRCN0000033779 CATGAAACACAAGAGCCGAAA pLKO.1 871 CDS 100% 4.050 2.835 N TRIM35 n/a
3 TRCN0000033782 CGCGTCTGGAAGAAGATGCTT pLKO.1 980 CDS 100% 3.000 2.100 N TRIM35 n/a
4 TRCN0000033781 AGTGTCAAGGAAGAACTGGAT pLKO.1 1568 CDS 100% 2.640 1.848 N TRIM35 n/a
5 TRCN0000033783 GCGCTGGACCAGCTACCGCTT pLKO.1 270 5UTR 100% 0.000 0.000 N TRIM35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.