Transcript: Human XM_011544457.1

PREDICTED: Homo sapiens kinesin family member 13B (KIF13B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF13B (23303)
Length:
8829
CDS:
60..5603

Additional Resources:

NCBI RefSeq record:
XM_011544457.1
NBCI Gene record:
KIF13B (23303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417061 GATCCGATGCAGTCCATATTA pLKO_005 1872 CDS 100% 15.000 21.000 N KIF13B n/a
2 TRCN0000429087 ACCTTATGTCGACGGACTTTC pLKO_005 599 CDS 100% 10.800 15.120 N KIF13B n/a
3 TRCN0000415492 CAAATCCTTCGTGCCGCAAAT pLKO_005 4484 CDS 100% 10.800 15.120 N KIF13B n/a
4 TRCN0000113941 CCCACTAATGTCTTAACCTAA pLKO.1 5962 3UTR 100% 4.950 6.930 N KIF13B n/a
5 TRCN0000432175 ATGTTGCTCTTTCTATCATTT pLKO_005 5928 3UTR 100% 13.200 9.240 N KIF13B n/a
6 TRCN0000113945 CCTCCATGAAGAACGAGAATA pLKO.1 1738 CDS 100% 13.200 9.240 N KIF13B n/a
7 TRCN0000436102 GAACCCTGAGAACCGGAAATC pLKO_005 5570 CDS 100% 10.800 7.560 N KIF13B n/a
8 TRCN0000113942 CCCAGTAATACGATCATACTT pLKO.1 2390 CDS 100% 5.625 3.938 N KIF13B n/a
9 TRCN0000113943 CCGAAGGTGTTTGCTTATGAT pLKO.1 216 CDS 100% 5.625 3.938 N KIF13B n/a
10 TRCN0000113944 GCCTTGAAGATCTGCGACAAA pLKO.1 4695 CDS 100% 4.950 3.465 N KIF13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.