Transcript: Human XM_011544575.2

PREDICTED: Homo sapiens integrator complex subunit 9 (INTS9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS9 (55756)
Length:
3033
CDS:
590..2548

Additional Resources:

NCBI RefSeq record:
XM_011544575.2
NBCI Gene record:
INTS9 (55756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276041 CTAGTCTCAATACCGTCATAT pLKO_005 1761 CDS 100% 0.000 0.000 N INTS9 n/a
2 TRCN0000275991 GAGACTTCAGCAACGACTTTA pLKO_005 1659 CDS 100% 13.200 9.240 N INTS9 n/a
3 TRCN0000275992 TTACCAGAGACGGAGCTAATA pLKO_005 770 CDS 100% 13.200 9.240 N INTS9 n/a
4 TRCN0000129616 CCAGGTGTCAAAGCTGCTTAA pLKO.1 1882 CDS 100% 10.800 7.560 N INTS9 n/a
5 TRCN0000127516 CCTTTCAACTTCAGGCTCATT pLKO.1 2740 3UTR 100% 4.950 3.465 N INTS9 n/a
6 TRCN0000285474 CCTTTCAACTTCAGGCTCATT pLKO_005 2740 3UTR 100% 4.950 3.465 N INTS9 n/a
7 TRCN0000131100 GCACTGTTTCAGGCAAGAACT pLKO.1 2716 3UTR 100% 4.950 3.465 N INTS9 n/a
8 TRCN0000131002 CATCTGAGCTACTTCCCTGAA pLKO.1 2555 3UTR 100% 4.050 2.835 N INTS9 n/a
9 TRCN0000275994 CATCTGAGCTACTTCCCTGAA pLKO_005 2555 3UTR 100% 4.050 2.835 N INTS9 n/a
10 TRCN0000128093 CTACCCTCAATTTCCTTCCTT pLKO.1 618 CDS 100% 3.000 2.100 N INTS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.