Transcript: Human XM_011544712.2

PREDICTED: Homo sapiens N-acetylated alpha-linked acidic dipeptidase like 1 (NAALADL1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAALADL1 (10004)
Length:
1978
CDS:
360..1886

Additional Resources:

NCBI RefSeq record:
XM_011544712.2
NBCI Gene record:
NAALADL1 (10004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073941 AGGCTCCTACTACGAGTATTT pLKO.1 1097 CDS 100% 13.200 18.480 N NAALADL1 n/a
2 TRCN0000436493 TGTAACCTCAACGGAACTTTG pLKO_005 1245 CDS 100% 10.800 15.120 N NAALADL1 n/a
3 TRCN0000073938 CCAGATGTGGTACAACCCTAT pLKO.1 789 CDS 100% 4.050 5.670 N NAALADL1 n/a
4 TRCN0000073939 CCTCGCAGATCAATCGTGTTT pLKO.1 1569 CDS 100% 4.950 3.960 N NAALADL1 n/a
5 TRCN0000073942 GCATCAAACTTGAAGGCACCA pLKO.1 901 CDS 100% 2.160 1.512 N NAALADL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.