Transcript: Human XM_011545124.2

PREDICTED: Homo sapiens anoctamin 1 (ANO1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO1 (55107)
Length:
4554
CDS:
14..3028

Additional Resources:

NCBI RefSeq record:
XM_011545124.2
NBCI Gene record:
ANO1 (55107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040265 CATCGGAATCTGGTACAATAT pLKO.1 2413 CDS 100% 13.200 18.480 N ANO1 n/a
2 TRCN0000422772 TGCAGATCTGCAGGTATAAAG pLKO_005 2643 CDS 100% 13.200 18.480 N ANO1 n/a
3 TRCN0000426487 TGGCTGGTAATACGGCAATAA pLKO_005 3272 3UTR 100% 13.200 18.480 N ANO1 n/a
4 TRCN0000440455 CTGATGCCGAGTGCAAGTATG pLKO_005 147 CDS 100% 10.800 8.640 N ANO1 n/a
5 TRCN0000040266 CGACCTGGTCAGGAAGTATTT pLKO.1 1030 CDS 100% 13.200 9.240 N ANO1 n/a
6 TRCN0000040263 CGTCGAGTTCAACGACAGAAA pLKO.1 955 CDS 100% 4.950 3.465 N ANO1 n/a
7 TRCN0000040267 GCTGATCCAGAACAACCTGTT pLKO.1 2083 CDS 100% 4.050 2.835 N ANO1 n/a
8 TRCN0000040264 CCTCACTAACTTGGTCTCCAT pLKO.1 1615 CDS 100% 2.640 1.848 N ANO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.