Transcript: Human XM_011545150.1

PREDICTED: Homo sapiens ring finger protein 121 (RNF121), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF121 (55298)
Length:
2451
CDS:
429..1169

Additional Resources:

NCBI RefSeq record:
XM_011545150.1
NBCI Gene record:
RNF121 (55298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424542 AGCTAACGTACTCAGGCTTGT pLKO_005 1620 3UTR 100% 4.050 5.670 N RNF121 n/a
2 TRCN0000007725 CATGGCATCTACCATAGGGTT pLKO.1 794 CDS 100% 2.640 3.696 N RNF121 n/a
3 TRCN0000435683 GTGGTTCCTGCTAATCTATAA pLKO_005 596 CDS 100% 13.200 9.240 N RNF121 n/a
4 TRCN0000366929 GTTTACCCTCTTTGGTCTTAA pLKO_005 659 CDS 100% 13.200 9.240 N Rnf121 n/a
5 TRCN0000417306 AGAGGCCTCACGTCATGTATG pLKO_005 1054 CDS 100% 10.800 7.560 N RNF121 n/a
6 TRCN0000434015 AGCCTGGTGCACTTAGTATAG pLKO_005 1596 3UTR 100% 10.800 7.560 N RNF121 n/a
7 TRCN0000418949 GATCATTGAGAACACGTATAG pLKO_005 908 CDS 100% 10.800 7.560 N RNF121 n/a
8 TRCN0000007723 CCTAGTGATCTGGATCTTGTT pLKO.1 497 CDS 100% 4.950 3.465 N RNF121 n/a
9 TRCN0000007722 GCTGTCATGTTTACCCTCTTT pLKO.1 651 CDS 100% 4.950 3.465 N RNF121 n/a
10 TRCN0000007724 CAGCCTGTCATCATTGGTGTA pLKO.1 1113 CDS 100% 4.050 2.835 N RNF121 n/a
11 TRCN0000419290 GAGTTCTGGAACGGGACTTTG pLKO_005 754 CDS 100% 10.800 6.480 N RNF121 n/a
12 TRCN0000375751 TCTTCTATGGCCTCTACTATG pLKO_005 733 CDS 100% 10.800 6.480 N Rnf121 n/a
13 TRCN0000432148 TGCTGTCACAGCCTTTGTTAC pLKO_005 521 CDS 100% 10.800 6.480 N RNF121 n/a
14 TRCN0000007721 GCCTCAGAATTCATTGAAGAT pLKO.1 1803 3UTR 100% 0.000 0.000 N RNF121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.