Transcript: Human XM_011545164.2

PREDICTED: Homo sapiens phosphofurin acidic cluster sorting protein 1 (PACS1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACS1 (55690)
Length:
5358
CDS:
1342..3894

Additional Resources:

NCBI RefSeq record:
XM_011545164.2
NBCI Gene record:
PACS1 (55690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141489 CGGCATAAGTTCCCTGATGAA pLKO.1 3199 CDS 100% 4.950 6.930 N PACS1 n/a
2 TRCN0000141563 CCTATGGAATTGGCTGCTCTA pLKO.1 2293 CDS 100% 4.050 5.670 N PACS1 n/a
3 TRCN0000145159 GCGGTTTAAAGTTTCAGATGA pLKO.1 2019 CDS 100% 4.950 3.960 N PACS1 n/a
4 TRCN0000141406 CCGACTTCCAAACTCTTCCTT pLKO.1 4204 3UTR 100% 3.000 2.400 N PACS1 n/a
5 TRCN0000142242 GAGGTGATGCAGCATCCTAAT pLKO.1 1660 CDS 100% 10.800 7.560 N PACS1 n/a
6 TRCN0000142917 CAAGAAAGTTCCCACCATCTT pLKO.1 3651 CDS 100% 4.950 3.465 N PACS1 n/a
7 TRCN0000143677 GTGGAGTGACATCAAGTTCTT pLKO.1 3798 CDS 100% 4.950 3.465 N PACS1 n/a
8 TRCN0000122204 GATTCCAAGAAAGGTGGTGTA pLKO.1 2628 CDS 100% 4.050 2.835 N PACS1 n/a
9 TRCN0000142393 GTTTCAGATGAGGTGGGCTTT pLKO.1 2029 CDS 100% 4.050 2.835 N PACS1 n/a
10 TRCN0000143648 CCTTGTGGTATCAGTTTCCTT pLKO.1 4221 3UTR 100% 3.000 2.100 N PACS1 n/a
11 TRCN0000142358 GCAGATTCCAAGAAAGGTGGT pLKO.1 2625 CDS 100% 2.160 1.296 N PACS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.