Transcript: Human XM_011545328.2

PREDICTED: Homo sapiens cathepsin F (CTSF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTSF (8722)
Length:
1765
CDS:
21..1295

Additional Resources:

NCBI RefSeq record:
XM_011545328.2
NBCI Gene record:
CTSF (8722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296743 ATTACCTATAACCGGACATAT pLKO_005 414 CDS 100% 13.200 18.480 N CTSF n/a
2 TRCN0000046631 CCTGTCCGTCTTTGTCAATAA pLKO.1 461 CDS 100% 13.200 18.480 N CTSF n/a
3 TRCN0000290585 CCTGTCCGTCTTTGTCAATAA pLKO_005 461 CDS 100% 13.200 18.480 N CTSF n/a
4 TRCN0000046629 CGAGACTTTCAGCTCAGTCAT pLKO.1 320 CDS 100% 4.950 3.465 N CTSF n/a
5 TRCN0000290584 CGAGACTTTCAGCTCAGTCAT pLKO_005 320 CDS 100% 4.950 3.465 N CTSF n/a
6 TRCN0000046630 CCTGGCAACAAGATGAAGCAA pLKO.1 609 CDS 100% 3.000 2.100 N CTSF n/a
7 TRCN0000046632 GCTCTTGGACTGTGACAAGAT pLKO.1 806 CDS 100% 0.495 0.347 N CTSF n/a
8 TRCN0000046628 GCCTGTGAAGATGGCTTCAAT pLKO.1 377 CDS 100% 0.563 0.338 N CTSF n/a
9 TRCN0000290643 GCCTGTGAAGATGGCTTCAAT pLKO_005 377 CDS 100% 0.563 0.338 N CTSF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.