Transcript: Human XM_011545824.3

PREDICTED: Homo sapiens acyl-CoA synthetase medium chain family member 2B (ACSM2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSM2B (348158)
Length:
1840
CDS:
231..1727

Additional Resources:

NCBI RefSeq record:
XM_011545824.3
NBCI Gene record:
ACSM2B (348158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418068 GACGGGCAGATGATATCATTA pLKO_005 1372 CDS 100% 13.200 7.920 N ACSM2B n/a
2 TRCN0000048559 CCCTATTGTTTACCGGATGTT pLKO.1 926 CDS 100% 4.950 2.970 N ACSM2B n/a
3 TRCN0000423707 AGTTTGACCCACTGGTTATTC pLKO_005 862 CDS 100% 13.200 6.600 Y ACSM2B n/a
4 TRCN0000048562 GCAGGATCTTTCCAGTTACAA pLKO.1 953 CDS 100% 5.625 2.813 Y ACSM2B n/a
5 TRCN0000147149 CCAGTTATCCAATCAAGAGTA pLKO.1 895 CDS 100% 4.950 2.475 Y ACSM2A n/a
6 TRCN0000048558 CGGGATTAACTTGCATGGTTT pLKO.1 1090 CDS 100% 4.950 2.475 Y ACSM2B n/a
7 TRCN0000147477 GTACCCAAGAAAGATAGAGTT pLKO.1 1610 CDS 100% 0.000 0.000 Y ACSM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.