Transcript: Human XM_011545897.3

PREDICTED: Homo sapiens VPS35 endosomal protein sorting factor like (VPS35L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS35L (57020)
Length:
2921
CDS:
272..2275

Additional Resources:

NCBI RefSeq record:
XM_011545897.3
NBCI Gene record:
VPS35L (57020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137133 CATAGACAAAGTGGACTCCAA pLKO.1 1900 CDS 100% 2.640 3.696 N VPS35L n/a
2 TRCN0000134172 CCAGGTTATTCTGACAATGAA pLKO.1 2423 3UTR 100% 5.625 3.938 N VPS35L n/a
3 TRCN0000136923 CCTGTTCTTGTGCAGTTGATT pLKO.1 1388 CDS 100% 5.625 3.938 N VPS35L n/a
4 TRCN0000136719 CGAGATGATGGAAAGGTGTAA pLKO.1 619 CDS 100% 4.950 3.465 N VPS35L n/a
5 TRCN0000349584 CGAGATGATGGAAAGGTGTAA pLKO_005 619 CDS 100% 4.950 3.465 N VPS35L n/a
6 TRCN0000133703 GCCTTTATCAAGCATCAACAA pLKO.1 1157 CDS 100% 4.950 3.465 N VPS35L n/a
7 TRCN0000318953 GCCTTTATCAAGCATCAACAA pLKO_005 1157 CDS 100% 4.950 3.465 N VPS35L n/a
8 TRCN0000138002 GCCTGTTCTTGTGCAGTTGAT pLKO.1 1387 CDS 100% 4.950 2.970 N VPS35L n/a
9 TRCN0000318947 GCCTGTTCTTGTGCAGTTGAT pLKO_005 1387 CDS 100% 4.950 2.970 N VPS35L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.