Transcript: Human XM_017000053.1

PREDICTED: Homo sapiens vav guanine nucleotide exchange factor 3 (VAV3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VAV3 (10451)
Length:
4689
CDS:
48..2519

Additional Resources:

NCBI RefSeq record:
XM_017000053.1
NBCI Gene record:
VAV3 (10451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047700 CCAATAATCCTACAACCGATA pLKO.1 1405 CDS 100% 4.050 5.670 N VAV3 n/a
2 TRCN0000047698 CCGAACTTATTAATAGGGTAA pLKO.1 2026 CDS 100% 4.050 5.670 N VAV3 n/a
3 TRCN0000047702 CGAAGTTGTTGTCTAGCAGAA pLKO.1 624 CDS 100% 4.050 5.670 N VAV3 n/a
4 TRCN0000428404 GAGATGGTGAAATTCGAATAA pLKO_005 1255 CDS 100% 13.200 10.560 N VAV3 n/a
5 TRCN0000047699 CGGAACCTAATGCAAGAGATT pLKO.1 783 CDS 100% 4.950 3.465 N VAV3 n/a
6 TRCN0000047701 CCAGTAGATTATTCTTGCCAA pLKO.1 1965 CDS 100% 2.640 1.848 N VAV3 n/a
7 TRCN0000097126 CCATCCACATATGTGGAAGAA pLKO.1 2490 CDS 100% 0.000 0.000 N Vav3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.